circad | circRNAs associated with diseases

hsa_circ_0020397
Gene	DOCK1	Organism	Human
Genome Locus	chr10:128768965-128926028:+	Build	hg19
Disease	Colorectal Cancer	ICD-10	Malignant neoplasm of rectosigmoid junction (C19)
DBLink	Link to database	PMID	28707774
Experimental Method
Sample Type	Cell Lines	Comparison	human colonic epithelial cells (CCD 841 CoN) and colorectal cell lines (LoVo, HCT116, SW480 and SW620)
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GACCGTGAACCGAACCGTCATTTC Reverse TCATCCGCTCCTC TGGCATCATAG	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Zhang, XL, Xu, LL, Wang, F (2017). Hsa_circ_0020397 regulates colorectal cancer cell viability, apoptosis and invasion by promoting the expression of the miR-138 targets TERT and PD-L1. Cell Biol. Int., 41, 9:1056-1064.